Warning: Undefined array key "username" in /home/biotechcourse/public_html/ICBGD2021.php on line 58 Optimization of loop mediated idothermal amplification (LAMP) assay for the detection of Leishmania DNA in Blood samples
Warning: Undefined variable $afaf2 in /home/biotechcourse/public_html/ICBGD2021.php on line 188
Warning: Undefined variable $afaf3 in /home/biotechcourse/public_html/ICBGD2021.php on line 189
Warning: Undefined variable $afaf4 in /home/biotechcourse/public_html/ICBGD2021.php on line 190
Warning: Undefined variable $afaf5 in /home/biotechcourse/public_html/ICBGD2021.php on line 191
Warning: Undefined variable $afaf6 in /home/biotechcourse/public_html/ICBGD2021.php on line 192
Introduction: A large group of diseases caused by Leishmania speciesare called leishmaniasis. Leishmania is a protozoan parasite and belongs to the trypanozomatidae family(Gualda et al., 2015). The development of skin-mucosal, cutaneous or visceral disease depends on the immune response of the host and specific species of Leishmania(Andreadou et al., 2014). In 89 countries, Leishmaniasis is recognized as an endemic disease and more than 350 million people are affected(Mohammadiha et al., 2013). Half a million cases are added annually and 50000 cases have died. Leishmania parasites are transmitted to humans by infected mosquito bites (Phlebotomine sandfly)(Gao et al., 2015). Leishmania infantum or Chagasi causes Visceral Leishmaniasis (VL) and Kala-azar and is often fatal(Verma et al., 2013). VL is a zoonotic and endemic disease in northwest and southern Iran(Verma et al., 2013). VL could be fatal if not treated. Therefore, it is important to diagnose this disease accurately. The disease has symptoms similar to other diseases and makes diagnosis more difficult and complex. VL is the second cause of tropical diseases and the average death rate is 20000 to 40000 deaths annually(Yurchenko et al., 1999; da Silva et al., 2013). The definitive diagnosis of Leishmaniasis is based on clinical, epidemiological, and laboratory tests. Common methods are serologic and parasitology test and these make it possible to diagnose Leishmaniasis reliably. Parasitological studies showed that Leishmania infantum presents in liver, spleen aspiration, lymph nodes, and bone marrow. Many patients are not properly diagnosed because the sensitivity of the microscopic studies is low(da Silva et al., 2013).
In general, serologic methods are not valuable to evaluate treatment because the results remain positive for months or years after clinical treatment and they may not be good criteria for infection diagnosis. These tests cannot be used in relapses because the antibodies remain after treatment for a long time, many people have high antibody titers against the disease in endemic areas because they contact with these species for a long time and have asymptomatic infections(Poon et al., 2006). In addition, serologic tests such as indirect immunofluorescence assay (IFA), Enzyme-linked immunosorbent assay (ELISA), have false negative results and cross-react with other diseases(Poon et al., 2006). Direct examination is inexpensive and easy, but when the number of parasites is low in the tissue, these tests lack sensitivity and require high skill. Also parasites culture takes a long time and requires special conditions(Poon et al., 2006). PCR methods are better than old methods and are highly sensitive and have less invasive sampling because peripheral blood specimens can be used. The sensitivity of PCR methods is different and depends on the target sequence and the most common target gene sequences are ITS1 and Kinetoplast minicircle genes (kDNA)(Gao et al., 2015). Real-time PCR is a molecular method. Compared with common PCR, it has high sensitivity of detection especially for blood specimens. In addition, the test time is short because electrophoresis is not required. However, Real-time PCR has limitations such as high cost, the need for special equipment, skillful people and a system for diagnosis and analysis(da Silva et al., 2013). Firstly LAMP was introduced by Notomie in 2000. This method has a high sensitivity and rapidity for DNA replication at a constant temperature (60-65 ºC)(Yurchenko et al., 1999). Abbasi et al. (2013) evaluated the performance of LAMP to detect low concentrations of Leishmania DNA in biological specimens and the results showed that LAMP and Real-time PCR had high sensitivity and the detection limit was 1 fg of the target DNA in each reaction(Abbasi et al., 2013). In addition, Chun-hua Gao et al. (2015) showed that the detection limit of LAMP was 1 fg of Leishmania infantum DNA in Canine VL sample(Gao et al., 2015). The LAMP technique is more sensitive than other assays such as PCR, ELISA, and microscopic methods for detection of Leishmania in dogs(Hamburger et al., 2013). Some researchers observed that the LAMP causes the mixture of reaction to become turbid (which shows DNA replication) and does not require electrophoresis. Also, it is more sensitive than PCR for detection(Yurchenko et al., 1999).
For VL diagnosis, the gold standard is mainly the detection of parasites in splenic aspiration culture, but it causes bleeding and requires surgery(Koltas et al., 2016; Toubanaki et al., 2016). Overall, there is no acceptable gold standard for the Leishmaniasis diagnosis, so far(Koltas et al., 2016). According to the problems for the Leishmaniasis diagnosis in other molecular methods, we designed the experiment to increase the rapidity, accuracy, specificity, and convenience of the test. The LAMP can replicate small copies of DNA (109 molecules) in isothermal conditions for one hour.
In this study, we designed a set of primers for LAMP DNA amplification appropriate for the detection of Leishmania infantum, major, and tropica using ITS2 as region. The sensitivity and specificity of LAMP assay were tested by clinical samples.
Methods: Ethical concerns
Study procedures were approved by the ethical committee at Fasa University of Medical Sciences, and the ethical code is IR.FUMS.REC.1395.130.
Sample
Genomic DNA was obtained from the following Leishmania reference strains: L.major (MHOM/IR/75/ER), L. infantum (MCAN/IR/97/LON490), L. tropica (MHOM/SU/74/K27). These were provided by the parasitology department of Shiraz University of Medical Sciences.
DNA Extraction
The Leishmania was cultured in RPMI 1640 medium (which contained 10 to 15% fetal bovine serum (FBS), penicillin and streptomycin antibiotics). After the number of parasites reached one million per ml, DNA was extracted by yekta tajhiz azma (YTA) kit with cat No: YT 9030 according to the following steps:
First, 200 µl of the TG1 buffer was mixed with the sample by pipetting and 20 µl Proteinase K was added to the sample and these were mixed by vortex. The mixture was incubated at 60 ºC for one hour and was mixed every 10 to 15 minutes by vortex and the lysis process was completed. Then TG2 buffer (200µl) was added and mixed and incubated at 70 ºC for 10 minutes and ethanol (200µl) was added and these combinations were mixed by vortex. The column was placed in a new collection tube and washed with water buffer (500µ1) and centrifuged at 1400 rpm for one minute, and the bottom solution was discarded. The column was washed with water buffer (850µl) and centrifuged at 1400 rpm for 1 minute then tube bottom solution was discarded, and centrifuged at 1400 rpm for three minutes to dry the column completely. The column was placed in the elution tube and the elution buffer (50 µl) was added to the column center and remained in the same position for three minutes. In addition, the centrifuge was carried out at 1400 rpm for 2 minutes, and the extracted DNA was stored at – 20 ºC.
LAMP Primer Design
The LAMP primer sets (external primers: F3 and B3, internal primers: FIP and BIP) were designed using Primer Explorer software (http://primerexplorer.jp/e/) based on shared ITS2 DNA sequences of L. infantum, major, and tropica (Table 1). The locations of the targeted sequences are shown within the conserved Leishmania ITS2 region in Fig.1.
Table1. Nucleotide sequences of LAMP primers designed for detection of L.major (MHOM/IR/75/ER), L. infantum (MCAN/IR/97/LON490), L. tropica (MHOM/SU/74/K27) ITS2 region.
Sequence PRIMER TM Region
ACCAAAACGAGAATTCAACTT F3 52.01 ITS2
TCTTTTTTCTCTGTGCGTAC B3 53.20
TACCACACAGAGAGAGAGCCACCGTTGGCCATTTTTTGCT FIP 73.55
TAGAAGTAGGTTGTGTGTGTGTATGTATGAGAGAGTGAGGGCG BIP 73.25
Fig1. DNA sequences of the 3 species of Leishmania ITS2 region showing the location of the LAMP primers on the sequences shared by different Leishmania species.
LAMP assays
The total volume of LAMP reaction mixture was 25 µl that contain 2.5 µl enzyme reaction buffer (New England Biolabs inc., MA, USA), 40 pmoles FIP and BIP, 5 pmoles F3 and B3 external primers, 8 units of Bst polymerase (New England Biolabs inc., MA, USA), 1.4 mM dNTP mixture; 0.8 M Betaine and DNA template 1 µl. The LAMP reaction mixture carried out at 60 ºC for 2 hours in water bath. The color of specimens changed by the addition of SYBR Green I in the micro-tubes.
Conventional PCR, Real-time PCR, Nested PCR
To compare the molecular techniques a conventional PCR, Real-time PCR, Nested PCR for detection of L.infantum DNA was performed. Primers were designed by GENE Runner software, cheeked by primer3 online software of NCBI (Table 2).
.
Table2. A: The sequences of PCR primers for Leishmania infantum; B: The sequences of PCR primers for Leishmania major, Leishmania tropica; C: Nested PCR (intra primers); D: Nested PCR (extra primers); E: The sequences of Real Time PCR primer sequence.
Product size(bp) Sequence Primer TM Region
977 CATTTTCCGATGATTACACCCAA Forward 53.76 18S
ITS1, 5.8S, ITS2
TCTTTTTTCTCTGTGCGTAC Reverse 53.2
1059 CATTTTCCGATGATTACACCCAA
Forward
53.76
18S
ITS1, 5.8S, ITS2
AAGTTCGGCGGGTAGTC Reverse 55.18
189 AACTCCTCTCTGGTGCTTGC Forward 59.35 ITS2, (IN)
AAAATGGCCAACGCGAAGTT Reverse 55.25
439 AGGCGTGTGTTTGTGTTGTG Forward 57.3 ITS1, 5.8S, ITS2 (EXT)
AGAGTGAGGGCGCGGATA Reverse 58.24
137 AGGCGTGTGTTTGTGTTGTG Forward 57.3 ITS2
GCAAGCACCAGAGAGGAGTT
Backward 59.3
Specificity and Sensitivity of LAMP Reaction
a) Specificity
Toxoplasma gondii, Trypanosoma cruzi, Cryptosporidium parvum, and Escherichia coli DNA samples were used as negative control sample to evaluate the specificity of the LAMP assay.
b)Sensitivity
LAMP reaction conditions were tested on serial dilutions of plasmid HPV DNA to confirm minimum copy number detection thresholds. For this purpose After PCR of this region the sequencing was confirmed whit sequencing and the fragments were prepared for cloning. E.coli TOP10 was used as host and pTZ57R/T plasmid as vector and the thermo scientific, TA-cloning kit, Cat No. K1214 was used at some stages. The concentrations of extracted plasmid of all three Leishmania strains were measured by spectrophotometer. LAMP was carried out to evaluate sensitivity on Ten-fold serial dilutions (n = 9) of the concentrations of extracted plasmid were prepared in PBS Buffer resulting in a range from 34.2ng to 34.2fg/µl (Fig2).
Fig 2. Serial dilution of Plasmid that cloned with 18s, ITS1, 5.8s and ITS2 region
Clinical samples:
The sensitivity and specificity of LAMP assay for detection of VL were analyzed in clinical samples blood from human, and five samples obtained from dog. The samples were placed in eppendorf and stored at -20 ºC for later DNA extraction. 10 of 15 clinical samples were obtained from human were confirmed by PCR and ELISA (enzyme-linked immunosorbent assay). Clinical signs for approval VL were also confirmed by a specialist at the Valfajr Moolecular Center and 5 peripheral blood samples that obtain from dog were confirmed by Shiraz Parasitology Department.
Results: Specificity and Sensitivity of LAMP assay for detection leishmania
The results was shown all of negative controls (Toxoplasma gondii, Trypanosoma cruzi, Cryptosporidium parvum, and Escherichia coli) samples were negative. The sensitivity of the LAMP assay for Leishmania infantum, major, and tropica strains was 400, 4×107, 4×107 copy number of plasmid DNA, respectively (Fig 3). The results showed that these primers detected 4 × 102 Leishmania infantum plasmids in the LAMP method and each parasite had about 200 ITS2, so this method can detect about 2 parasites per 1µl.
Fig3. A: The LAMP assay on Leishmania infantum plasmid serial dilutions which was showed that eight tube was positive and other tubes and negative control tube were negative. B: The LAMP assay on Leishmania major plasmid serial dilutions which was showed that third tube was positive and other tubes and negative control tube were negative. C: The LAMP test on the third colony of plasmids for Leishmania tropica which was showed that first to fourth tubes were positive and the negative control tube was negative.
LAMP assay was carried out on clinical specimens and the results showed that 12 of 15 specimens were positive, so its sensitivity was 80% (Fig 4).
Fig4: The color of specimens changed by the addition of SYBR Green I in the micro-tubes.
Conventional PCR, Real-time PCR, Nested PCR
In this study, conventional PCR, Nested PCR and Real-time PCR were examine on the serial dilution of cloning plasmid that Contains 18s, ITS1, 5.8s and ITS2 region of standards L. infantum, major and tropica strains. Fig. 5 demonstrates the copy number detection threshold for each strains. Conversional PCR detected 4×105, 4×108, and 4×108 of Lishmania DNA for L.infantum, L.major and L.tropica, respectively. Nested PCR detected 4×105, 4×107, and 4×105 of Lishmania DNA for L.infantum, L.major and L.tropica, respectively Real-time PCR detected 400 copies of all Lishmania strains DNA (Fig.5).
Fig5: the copy number detection limit of three molecular method for each strains. Real Time PCR was The most sensitive method for detection leishmania strains.
Conclusion: The results showed that Real-time PCR is more sensitive than Nested PCR to detect Leishmania infantum. The LAMP is similar to Real-time PCR for detection of Leishmaniasis and it is more sensitive than other molecular methods. The LAMP assay is a rapid, accurate, and easy method that can be used for detection of leishmania parasites in human and dog samples.