In-silico Analysis of suppressing of telomerase activity pathway by nc-RNA in human cancers
-
Alireza Seddigh,1 Alireza Salimi,2 Benjamin Babaei,3 Reza Salarinia,4,*
1. Department of Advanced Technologies, School of medicine, North Khorasan University of Medical Science, Bojnurd, Iran
2. Department of Advanced Technologies, School of medicine, North Khorasan University of Medical Science, Bojnurd, Iran
3. Department of Advanced Technologies, School of medicine, North Khorasan University of Medical Science, Bojnurd, Iran
4. Department of Advanced Technologies, School of medicine, North Khorasan University of Medical Science, Bojnurd, Iran
- Introduction: Cancer is the leading cause of death worldwide and its prevalence is expected to increase dramatically as the world population grows . Telomerase holoenzyme has long been recognized as an important target in cancer therapy because most cancer cells depend on sustained and increased telomerase activity for sustained proliferation and longevity . This study aims to find critical genes in the telomerase pathway, inhibit oncogene, and amplify suppress gene by ncRNA.
- Methods: In this study, at first, we using disgenet database for determining genes which are involve in telomerase pathway. Next, DAVID and Enrichr databases reveal critical genes from this gene list. For more analysis on our genes, we using GeneMANIA database. miRWalk, mirDB and TargetScan was used for determining miRNAs which potentially target these genes. Mir Path v.3 (Diana) was used to more analysis on our miRNAs.
Sequence data were extracted from NCBI for antisense design and then design by IDTDNA.
- Results: Our results confirmed that these genes of telomerase pathway activity had important roles in Melanoma, Thyroid cancer. Bladder cancer, Nasopharyngeal carcinoma, Basal cell carcinoma, Glioblastoma, Testicular germ cell cancer, Glioma, hepatocellular carcinoma, gastric cancer (TERT), Glioma, Glioblastoma, Basal cell carcinoma, carcinoma, basal cell, pancreatic cancer, breast cancer, colorectal cancer, hepatocellular carcinoma, gastric cancer, bladder cancer, (TP53), Nasopharyngeal carcinoma, Glioblastoma, Glioma, Melanoma, Basal cell carcinoma, pancreatic cancer, bladder cancer, bladder cancer (CDKN2A), Thyroid cancer, Bladder cancer, glioma, melanoma, hepatocellular carcinoma, gastric cancer (TERC).
And these genes could be inhibited by hsa-miR-130b-3p for TERC (lncRNA), hsa-miR-491-5p for TERT, hsa-miR-1203 antisense for TP53 and CDKN2A.
hsa-miR-1203 antisense:
GGAGCCAGGATGCAGCTCAAGCCAC
Hetro dimer with hsa-miR-1203:
Maximum ΔG (kcal. mole-1): -184.1 kcal/mole
- Conclusion: Telomerase is a holoenzyme complex and plays an important role in aging stem cells and immortal cancer cells.
Scientific discoveries concerning the control of TERT and TERC and other proteins related to telomerase by microRNA have altered our knowledge of telomeres and telomerase biology.
However, some proteins in our study, such as PINX1, PML
DKC1, WRAP53 have less evidence to relate to cancer but high potential for extensive research into cancer and treatment.
- Keywords: microRNA, Telomerase , TERT, TERC, CANCER
